Review



s mutans ua159 wild type strain  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    ATCC s mutans ua159 wild type strain
    Computational and experimental analysis of LSOS-MurI interaction. (a) Amino acid sequence alignment of S. mutans MurI and S. pyogenes MurI across 264 residues. Key pocket residues Ser11, Thr75, and Thr117 are highlighted in red boxes. Alignment color intensity reflects sequence similarity, with deeper purple indicating higher conservation. (b) Structural visualization of S. pyogenes MurI (PDB ID: 2OHV ) in complex with γ−2-naphthylmethyl- d -glutamate. Gray dashed lines represent hydrophobic interactions, yellow dashed lines indicate π-π stacking interactions, and blue solid lines denote hydrogen bonds interactions. (c) Docking interaction diagram of S. mutans MurI with LSOS. Yellow dashed lines indicate π-π stacking interactions, and blue solid lines represent hydrogen bond interactions. (d) Structural superposition of S. mutans MurI (blue) and S. pyogenes MurI (pink). γ−2-naphthylmethyl- d -glutamate is shown in yellow, and LSOS is shown in cyan. (e) Docking interaction diagram of S. mutans MurI with l -glutamate. Blue solid lines represent hydrogen bond interactions. (f) Docking interaction diagram of S. mutans MurI with d -glutamate. Blue solid lines represent hydrogen bond interactions. (g) Structural comparison of LSOS (right) with natural substrates l -glutamate (left) and d -glutamate (middle). (h) Circular dichroism spectra of MurI (6.25 μg/mL in 10 mM potassium phosphate, pH 7.8) after 2-hour pre-incubation with LSOS, using 5 mM l -glutamate as substrate. Based on standard CD principles, L/D-glutamate are expected to exhibit positive (L) and negative (D) ellipticity near 200–205 nm . LSOS, similar to L‑serine, is likely to show a positive band . Colored lines represent LSOS concentrations: green (0 mM), orange (1 mM), blue (2 mM), and red (5 mM). The red arrow indicates reduced ellipticity at 200–205 nm.
    S Mutans Ua159 Wild Type Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 660 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+mutans+wild+type+ua159+strain/pmc12744344-32-0-5?v=ATCC
    Average 95 stars, based on 660 article reviews
    s mutans ua159 wild type strain - by Bioz Stars, 2026-07
    95/100 stars

    Images

    1) Product Images from "L-serine-O-sulfate alters cellular ultrastructure and mitigates the capacity of biofilm formation in Streptococcus mutans UA159 via interfering with glutamate racemase"

    Article Title: L-serine-O-sulfate alters cellular ultrastructure and mitigates the capacity of biofilm formation in Streptococcus mutans UA159 via interfering with glutamate racemase

    Journal: Current Research in Microbial Sciences

    doi: 10.1016/j.crmicr.2025.100427

    Computational and experimental analysis of LSOS-MurI interaction. (a) Amino acid sequence alignment of S. mutans MurI and S. pyogenes MurI across 264 residues. Key pocket residues Ser11, Thr75, and Thr117 are highlighted in red boxes. Alignment color intensity reflects sequence similarity, with deeper purple indicating higher conservation. (b) Structural visualization of S. pyogenes MurI (PDB ID: 2OHV ) in complex with γ−2-naphthylmethyl- d -glutamate. Gray dashed lines represent hydrophobic interactions, yellow dashed lines indicate π-π stacking interactions, and blue solid lines denote hydrogen bonds interactions. (c) Docking interaction diagram of S. mutans MurI with LSOS. Yellow dashed lines indicate π-π stacking interactions, and blue solid lines represent hydrogen bond interactions. (d) Structural superposition of S. mutans MurI (blue) and S. pyogenes MurI (pink). γ−2-naphthylmethyl- d -glutamate is shown in yellow, and LSOS is shown in cyan. (e) Docking interaction diagram of S. mutans MurI with l -glutamate. Blue solid lines represent hydrogen bond interactions. (f) Docking interaction diagram of S. mutans MurI with d -glutamate. Blue solid lines represent hydrogen bond interactions. (g) Structural comparison of LSOS (right) with natural substrates l -glutamate (left) and d -glutamate (middle). (h) Circular dichroism spectra of MurI (6.25 μg/mL in 10 mM potassium phosphate, pH 7.8) after 2-hour pre-incubation with LSOS, using 5 mM l -glutamate as substrate. Based on standard CD principles, L/D-glutamate are expected to exhibit positive (L) and negative (D) ellipticity near 200–205 nm . LSOS, similar to L‑serine, is likely to show a positive band . Colored lines represent LSOS concentrations: green (0 mM), orange (1 mM), blue (2 mM), and red (5 mM). The red arrow indicates reduced ellipticity at 200–205 nm.
    Figure Legend Snippet: Computational and experimental analysis of LSOS-MurI interaction. (a) Amino acid sequence alignment of S. mutans MurI and S. pyogenes MurI across 264 residues. Key pocket residues Ser11, Thr75, and Thr117 are highlighted in red boxes. Alignment color intensity reflects sequence similarity, with deeper purple indicating higher conservation. (b) Structural visualization of S. pyogenes MurI (PDB ID: 2OHV ) in complex with γ−2-naphthylmethyl- d -glutamate. Gray dashed lines represent hydrophobic interactions, yellow dashed lines indicate π-π stacking interactions, and blue solid lines denote hydrogen bonds interactions. (c) Docking interaction diagram of S. mutans MurI with LSOS. Yellow dashed lines indicate π-π stacking interactions, and blue solid lines represent hydrogen bond interactions. (d) Structural superposition of S. mutans MurI (blue) and S. pyogenes MurI (pink). γ−2-naphthylmethyl- d -glutamate is shown in yellow, and LSOS is shown in cyan. (e) Docking interaction diagram of S. mutans MurI with l -glutamate. Blue solid lines represent hydrogen bond interactions. (f) Docking interaction diagram of S. mutans MurI with d -glutamate. Blue solid lines represent hydrogen bond interactions. (g) Structural comparison of LSOS (right) with natural substrates l -glutamate (left) and d -glutamate (middle). (h) Circular dichroism spectra of MurI (6.25 μg/mL in 10 mM potassium phosphate, pH 7.8) after 2-hour pre-incubation with LSOS, using 5 mM l -glutamate as substrate. Based on standard CD principles, L/D-glutamate are expected to exhibit positive (L) and negative (D) ellipticity near 200–205 nm . LSOS, similar to L‑serine, is likely to show a positive band . Colored lines represent LSOS concentrations: green (0 mM), orange (1 mM), blue (2 mM), and red (5 mM). The red arrow indicates reduced ellipticity at 200–205 nm.

    Techniques Used: Sequencing, Comparison, Circular Dichroism, Incubation

    LSOS impairs growth and induces cytoplasmic vacuolization in S. mutans UA159. (a) Growth curves of S. mutans UA159 under LSOS treatment ( n = 3). (b) Doubling time calculations from exponential growth phases. (c) Representative TEM images (× 59,000): top-left: untreated control; top-right: 2.5 mM LSOS (red stars indicate membrane blebs); bottom-left: 5.0 mM LSOS (arrows indicate cell lysis); bottom-right: penicillin control (0.04 μg/ml). Scale bars: 200 nm. (d) Violin plot of bleb-containing cells per field ( n = 10 images). * p -value compares 2.5 vs 5.0 mM groups.
    Figure Legend Snippet: LSOS impairs growth and induces cytoplasmic vacuolization in S. mutans UA159. (a) Growth curves of S. mutans UA159 under LSOS treatment ( n = 3). (b) Doubling time calculations from exponential growth phases. (c) Representative TEM images (× 59,000): top-left: untreated control; top-right: 2.5 mM LSOS (red stars indicate membrane blebs); bottom-left: 5.0 mM LSOS (arrows indicate cell lysis); bottom-right: penicillin control (0.04 μg/ml). Scale bars: 200 nm. (d) Violin plot of bleb-containing cells per field ( n = 10 images). * p -value compares 2.5 vs 5.0 mM groups.

    Techniques Used: Control, Membrane, Lysis

    LSOS impairs biofilm formation and extracellular matrix organization in S. mutans UA159. (a) CLSM images (20 ×) of 24-h biofilms: Viable bacteria (green), α-glucans (red), β-glucans (blue). Scale bar: 100 μm. (b) COMSTAT 2 quantification of bio-volume (left axis) and average thickness (right axis). Data: mean ± SD ( n = 3). (c) Left: Crystal violet absorbance at OD595nm; Right: Estimation plot of mean differences. Data: mean ± SD ( n = 3). (d) SEM micrographs (500 ×): untreated (left) vs 2.5 mM LSOS-treated (right) biofilms. Scale bars: 50 μm.
    Figure Legend Snippet: LSOS impairs biofilm formation and extracellular matrix organization in S. mutans UA159. (a) CLSM images (20 ×) of 24-h biofilms: Viable bacteria (green), α-glucans (red), β-glucans (blue). Scale bar: 100 μm. (b) COMSTAT 2 quantification of bio-volume (left axis) and average thickness (right axis). Data: mean ± SD ( n = 3). (c) Left: Crystal violet absorbance at OD595nm; Right: Estimation plot of mean differences. Data: mean ± SD ( n = 3). (d) SEM micrographs (500 ×): untreated (left) vs 2.5 mM LSOS-treated (right) biofilms. Scale bars: 50 μm.

    Techniques Used: Bacteria



    Similar Products

    95
    ATCC s mutans ua159 wild type strain
    Computational and experimental analysis of LSOS-MurI interaction. (a) Amino acid sequence alignment of S. mutans MurI and S. pyogenes MurI across 264 residues. Key pocket residues Ser11, Thr75, and Thr117 are highlighted in red boxes. Alignment color intensity reflects sequence similarity, with deeper purple indicating higher conservation. (b) Structural visualization of S. pyogenes MurI (PDB ID: 2OHV ) in complex with γ−2-naphthylmethyl- d -glutamate. Gray dashed lines represent hydrophobic interactions, yellow dashed lines indicate π-π stacking interactions, and blue solid lines denote hydrogen bonds interactions. (c) Docking interaction diagram of S. mutans MurI with LSOS. Yellow dashed lines indicate π-π stacking interactions, and blue solid lines represent hydrogen bond interactions. (d) Structural superposition of S. mutans MurI (blue) and S. pyogenes MurI (pink). γ−2-naphthylmethyl- d -glutamate is shown in yellow, and LSOS is shown in cyan. (e) Docking interaction diagram of S. mutans MurI with l -glutamate. Blue solid lines represent hydrogen bond interactions. (f) Docking interaction diagram of S. mutans MurI with d -glutamate. Blue solid lines represent hydrogen bond interactions. (g) Structural comparison of LSOS (right) with natural substrates l -glutamate (left) and d -glutamate (middle). (h) Circular dichroism spectra of MurI (6.25 μg/mL in 10 mM potassium phosphate, pH 7.8) after 2-hour pre-incubation with LSOS, using 5 mM l -glutamate as substrate. Based on standard CD principles, L/D-glutamate are expected to exhibit positive (L) and negative (D) ellipticity near 200–205 nm . LSOS, similar to L‑serine, is likely to show a positive band . Colored lines represent LSOS concentrations: green (0 mM), orange (1 mM), blue (2 mM), and red (5 mM). The red arrow indicates reduced ellipticity at 200–205 nm.
    S Mutans Ua159 Wild Type Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+mutans+wild+type+ua159+strain/pmc12744344-32-0-5?v=ATCC
    Average 95 stars, based on 1 article reviews
    s mutans ua159 wild type strain - by Bioz Stars, 2026-07
    95/100 stars
      Buy from Supplier

    95
    ATCC plasmids description source s mutans ua159 wild type strain atcc 700610 ua159 pdl278 ua159 pdl278
    Effect of smu_1361c on the growth, biofilm formation, and oxidative tolerance of S. mutans. (A) Growth characteristics of <t>UA159,</t> <t>UA159/pDL278,</t> UA159/pDL278-1361c, and UA159 Δ1361c. Bacteria were grown aerobically at 37°C, and OD600nm was monitored at 30-min intervals for 12 h. (B) The biofilm biomass was determined using crystal violet staining assay when bacteria were cultured in BHIS under aerobic conditions for 6, 12, and 24 h, respectively. The exponential cultures of UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c were exposed to oxidative stress with 0.2% (66.05 mM) hydrogen peroxide for 0, 20, 40, and 60 min, respectively, which were serially diluted and cultured on the BHI agar plates. The representative pictures of the hydrogen peroxide challenge are shown (C), colony-forming units were counted, and percent survivals of different strains were calculated relative to the control sample UA159 (D). The plates were overlaid with soft agar containing UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c and challenged with filter discs soaked with 0, 20, 40, and 60 mM hydrogen peroxide. The representative plates are shown to demonstrate the differences in inhibition zones (E), which are measured at three different positions and averaged to serve as a single data point, and the ratio of inhibition zone to disc diameter was calculated (F). Each experiment was repeated at least thrice. Results are presented as mean ± SD (*P < 0.05 or ***P < 0.001).
    Plasmids Description Source S Mutans Ua159 Wild Type Strain Atcc 700610 Ua159 Pdl278 Ua159 Pdl278, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+mutans+wild+type+ua159+strain/pmc10880606-353-4-12?v=ATCC
    Average 95 stars, based on 1 article reviews
    plasmids description source s mutans ua159 wild type strain atcc 700610 ua159 pdl278 ua159 pdl278 - by Bioz Stars, 2026-07
    95/100 stars
      Buy from Supplier

    95
    ATCC s mutans wild type ua159 strain
    Effect of smu_1361c on the growth, biofilm formation, and oxidative tolerance of S. mutans. (A) Growth characteristics of <t>UA159,</t> <t>UA159/pDL278,</t> UA159/pDL278-1361c, and UA159 Δ1361c. Bacteria were grown aerobically at 37°C, and OD600nm was monitored at 30-min intervals for 12 h. (B) The biofilm biomass was determined using crystal violet staining assay when bacteria were cultured in BHIS under aerobic conditions for 6, 12, and 24 h, respectively. The exponential cultures of UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c were exposed to oxidative stress with 0.2% (66.05 mM) hydrogen peroxide for 0, 20, 40, and 60 min, respectively, which were serially diluted and cultured on the BHI agar plates. The representative pictures of the hydrogen peroxide challenge are shown (C), colony-forming units were counted, and percent survivals of different strains were calculated relative to the control sample UA159 (D). The plates were overlaid with soft agar containing UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c and challenged with filter discs soaked with 0, 20, 40, and 60 mM hydrogen peroxide. The representative plates are shown to demonstrate the differences in inhibition zones (E), which are measured at three different positions and averaged to serve as a single data point, and the ratio of inhibition zone to disc diameter was calculated (F). Each experiment was repeated at least thrice. Results are presented as mean ± SD (*P < 0.05 or ***P < 0.001).
    S Mutans Wild Type Ua159 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+mutans+wild+type+ua159+strain/pm37695854-165-21-26?v=ATCC
    Average 95 stars, based on 1 article reviews
    s mutans wild type ua159 strain - by Bioz Stars, 2026-07
    95/100 stars
      Buy from Supplier

    95
    ATCC plasmid description source s. mutans ua159 wild type strain atcc 700610 ∆ahrc ua159∆ahrc
    Effect of smu_1361c on the growth, biofilm formation, and oxidative tolerance of S. mutans. (A) Growth characteristics of <t>UA159,</t> <t>UA159/pDL278,</t> UA159/pDL278-1361c, and UA159 Δ1361c. Bacteria were grown aerobically at 37°C, and OD600nm was monitored at 30-min intervals for 12 h. (B) The biofilm biomass was determined using crystal violet staining assay when bacteria were cultured in BHIS under aerobic conditions for 6, 12, and 24 h, respectively. The exponential cultures of UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c were exposed to oxidative stress with 0.2% (66.05 mM) hydrogen peroxide for 0, 20, 40, and 60 min, respectively, which were serially diluted and cultured on the BHI agar plates. The representative pictures of the hydrogen peroxide challenge are shown (C), colony-forming units were counted, and percent survivals of different strains were calculated relative to the control sample UA159 (D). The plates were overlaid with soft agar containing UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c and challenged with filter discs soaked with 0, 20, 40, and 60 mM hydrogen peroxide. The representative plates are shown to demonstrate the differences in inhibition zones (E), which are measured at three different positions and averaged to serve as a single data point, and the ratio of inhibition zone to disc diameter was calculated (F). Each experiment was repeated at least thrice. Results are presented as mean ± SD (*P < 0.05 or ***P < 0.001).
    Plasmid Description Source S. Mutans Ua159 Wild Type Strain Atcc 700610 ∆Ahrc Ua159∆Ahrc, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+mutans+wild+type+ua159+strain/pmc09430756__spectrum__00721___22___s0001-9-10-19?v=ATCC
    Average 95 stars, based on 1 article reviews
    plasmid description source s. mutans ua159 wild type strain atcc 700610 ∆ahrc ua159∆ahrc - by Bioz Stars, 2026-07
    95/100 stars
      Buy from Supplier

    96
    ATCC caption a7 s mutans strains relevant characteristics source ua159 wild type atcc δ adca adca
    Alignment of AdcA of S. mutans with AdcA and AdcAII proteins of S. agalactiae. Dark and light grey shades represent identical and similar residues, respectively. Orange shaded residues are the N-terminal histidine rich metal-binding motif, yellow boxed residues depict the C-terminal ZinT domain while the glutamic acid and additional histidine residues that aid in metal recruitment are indicated in blue shades.
    Caption A7 S Mutans Strains Relevant Characteristics Source Ua159 Wild Type Atcc δ Adca Adca, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+mutans+wild+type+ua159+strain/pmc09178666-207-25-35?v=ATCC
    Average 96 stars, based on 1 article reviews
    caption a7 s mutans strains relevant characteristics source ua159 wild type atcc δ adca adca - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    Image Search Results


    Computational and experimental analysis of LSOS-MurI interaction. (a) Amino acid sequence alignment of S. mutans MurI and S. pyogenes MurI across 264 residues. Key pocket residues Ser11, Thr75, and Thr117 are highlighted in red boxes. Alignment color intensity reflects sequence similarity, with deeper purple indicating higher conservation. (b) Structural visualization of S. pyogenes MurI (PDB ID: 2OHV ) in complex with γ−2-naphthylmethyl- d -glutamate. Gray dashed lines represent hydrophobic interactions, yellow dashed lines indicate π-π stacking interactions, and blue solid lines denote hydrogen bonds interactions. (c) Docking interaction diagram of S. mutans MurI with LSOS. Yellow dashed lines indicate π-π stacking interactions, and blue solid lines represent hydrogen bond interactions. (d) Structural superposition of S. mutans MurI (blue) and S. pyogenes MurI (pink). γ−2-naphthylmethyl- d -glutamate is shown in yellow, and LSOS is shown in cyan. (e) Docking interaction diagram of S. mutans MurI with l -glutamate. Blue solid lines represent hydrogen bond interactions. (f) Docking interaction diagram of S. mutans MurI with d -glutamate. Blue solid lines represent hydrogen bond interactions. (g) Structural comparison of LSOS (right) with natural substrates l -glutamate (left) and d -glutamate (middle). (h) Circular dichroism spectra of MurI (6.25 μg/mL in 10 mM potassium phosphate, pH 7.8) after 2-hour pre-incubation with LSOS, using 5 mM l -glutamate as substrate. Based on standard CD principles, L/D-glutamate are expected to exhibit positive (L) and negative (D) ellipticity near 200–205 nm . LSOS, similar to L‑serine, is likely to show a positive band . Colored lines represent LSOS concentrations: green (0 mM), orange (1 mM), blue (2 mM), and red (5 mM). The red arrow indicates reduced ellipticity at 200–205 nm.

    Journal: Current Research in Microbial Sciences

    Article Title: L-serine-O-sulfate alters cellular ultrastructure and mitigates the capacity of biofilm formation in Streptococcus mutans UA159 via interfering with glutamate racemase

    doi: 10.1016/j.crmicr.2025.100427

    Figure Lengend Snippet: Computational and experimental analysis of LSOS-MurI interaction. (a) Amino acid sequence alignment of S. mutans MurI and S. pyogenes MurI across 264 residues. Key pocket residues Ser11, Thr75, and Thr117 are highlighted in red boxes. Alignment color intensity reflects sequence similarity, with deeper purple indicating higher conservation. (b) Structural visualization of S. pyogenes MurI (PDB ID: 2OHV ) in complex with γ−2-naphthylmethyl- d -glutamate. Gray dashed lines represent hydrophobic interactions, yellow dashed lines indicate π-π stacking interactions, and blue solid lines denote hydrogen bonds interactions. (c) Docking interaction diagram of S. mutans MurI with LSOS. Yellow dashed lines indicate π-π stacking interactions, and blue solid lines represent hydrogen bond interactions. (d) Structural superposition of S. mutans MurI (blue) and S. pyogenes MurI (pink). γ−2-naphthylmethyl- d -glutamate is shown in yellow, and LSOS is shown in cyan. (e) Docking interaction diagram of S. mutans MurI with l -glutamate. Blue solid lines represent hydrogen bond interactions. (f) Docking interaction diagram of S. mutans MurI with d -glutamate. Blue solid lines represent hydrogen bond interactions. (g) Structural comparison of LSOS (right) with natural substrates l -glutamate (left) and d -glutamate (middle). (h) Circular dichroism spectra of MurI (6.25 μg/mL in 10 mM potassium phosphate, pH 7.8) after 2-hour pre-incubation with LSOS, using 5 mM l -glutamate as substrate. Based on standard CD principles, L/D-glutamate are expected to exhibit positive (L) and negative (D) ellipticity near 200–205 nm . LSOS, similar to L‑serine, is likely to show a positive band . Colored lines represent LSOS concentrations: green (0 mM), orange (1 mM), blue (2 mM), and red (5 mM). The red arrow indicates reduced ellipticity at 200–205 nm.

    Article Snippet: S. mutans UA159 wild-type strain (ATCC cat no 700,610) was cultured in Brain Heart Infusion (BHI) broth (Becton Dickinson, Sparks, MD, USA) under anaerobic conditions (85 % N 2 , 5 % CO 2 , 10 % H 2 ) at 37 °C.

    Techniques: Sequencing, Comparison, Circular Dichroism, Incubation

    LSOS impairs growth and induces cytoplasmic vacuolization in S. mutans UA159. (a) Growth curves of S. mutans UA159 under LSOS treatment ( n = 3). (b) Doubling time calculations from exponential growth phases. (c) Representative TEM images (× 59,000): top-left: untreated control; top-right: 2.5 mM LSOS (red stars indicate membrane blebs); bottom-left: 5.0 mM LSOS (arrows indicate cell lysis); bottom-right: penicillin control (0.04 μg/ml). Scale bars: 200 nm. (d) Violin plot of bleb-containing cells per field ( n = 10 images). * p -value compares 2.5 vs 5.0 mM groups.

    Journal: Current Research in Microbial Sciences

    Article Title: L-serine-O-sulfate alters cellular ultrastructure and mitigates the capacity of biofilm formation in Streptococcus mutans UA159 via interfering with glutamate racemase

    doi: 10.1016/j.crmicr.2025.100427

    Figure Lengend Snippet: LSOS impairs growth and induces cytoplasmic vacuolization in S. mutans UA159. (a) Growth curves of S. mutans UA159 under LSOS treatment ( n = 3). (b) Doubling time calculations from exponential growth phases. (c) Representative TEM images (× 59,000): top-left: untreated control; top-right: 2.5 mM LSOS (red stars indicate membrane blebs); bottom-left: 5.0 mM LSOS (arrows indicate cell lysis); bottom-right: penicillin control (0.04 μg/ml). Scale bars: 200 nm. (d) Violin plot of bleb-containing cells per field ( n = 10 images). * p -value compares 2.5 vs 5.0 mM groups.

    Article Snippet: S. mutans UA159 wild-type strain (ATCC cat no 700,610) was cultured in Brain Heart Infusion (BHI) broth (Becton Dickinson, Sparks, MD, USA) under anaerobic conditions (85 % N 2 , 5 % CO 2 , 10 % H 2 ) at 37 °C.

    Techniques: Control, Membrane, Lysis

    LSOS impairs biofilm formation and extracellular matrix organization in S. mutans UA159. (a) CLSM images (20 ×) of 24-h biofilms: Viable bacteria (green), α-glucans (red), β-glucans (blue). Scale bar: 100 μm. (b) COMSTAT 2 quantification of bio-volume (left axis) and average thickness (right axis). Data: mean ± SD ( n = 3). (c) Left: Crystal violet absorbance at OD595nm; Right: Estimation plot of mean differences. Data: mean ± SD ( n = 3). (d) SEM micrographs (500 ×): untreated (left) vs 2.5 mM LSOS-treated (right) biofilms. Scale bars: 50 μm.

    Journal: Current Research in Microbial Sciences

    Article Title: L-serine-O-sulfate alters cellular ultrastructure and mitigates the capacity of biofilm formation in Streptococcus mutans UA159 via interfering with glutamate racemase

    doi: 10.1016/j.crmicr.2025.100427

    Figure Lengend Snippet: LSOS impairs biofilm formation and extracellular matrix organization in S. mutans UA159. (a) CLSM images (20 ×) of 24-h biofilms: Viable bacteria (green), α-glucans (red), β-glucans (blue). Scale bar: 100 μm. (b) COMSTAT 2 quantification of bio-volume (left axis) and average thickness (right axis). Data: mean ± SD ( n = 3). (c) Left: Crystal violet absorbance at OD595nm; Right: Estimation plot of mean differences. Data: mean ± SD ( n = 3). (d) SEM micrographs (500 ×): untreated (left) vs 2.5 mM LSOS-treated (right) biofilms. Scale bars: 50 μm.

    Article Snippet: S. mutans UA159 wild-type strain (ATCC cat no 700,610) was cultured in Brain Heart Infusion (BHI) broth (Becton Dickinson, Sparks, MD, USA) under anaerobic conditions (85 % N 2 , 5 % CO 2 , 10 % H 2 ) at 37 °C.

    Techniques: Bacteria

    Effect of smu_1361c on the growth, biofilm formation, and oxidative tolerance of S. mutans. (A) Growth characteristics of UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c. Bacteria were grown aerobically at 37°C, and OD600nm was monitored at 30-min intervals for 12 h. (B) The biofilm biomass was determined using crystal violet staining assay when bacteria were cultured in BHIS under aerobic conditions for 6, 12, and 24 h, respectively. The exponential cultures of UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c were exposed to oxidative stress with 0.2% (66.05 mM) hydrogen peroxide for 0, 20, 40, and 60 min, respectively, which were serially diluted and cultured on the BHI agar plates. The representative pictures of the hydrogen peroxide challenge are shown (C), colony-forming units were counted, and percent survivals of different strains were calculated relative to the control sample UA159 (D). The plates were overlaid with soft agar containing UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c and challenged with filter discs soaked with 0, 20, 40, and 60 mM hydrogen peroxide. The representative plates are shown to demonstrate the differences in inhibition zones (E), which are measured at three different positions and averaged to serve as a single data point, and the ratio of inhibition zone to disc diameter was calculated (F). Each experiment was repeated at least thrice. Results are presented as mean ± SD (*P < 0.05 or ***P < 0.001).

    Journal: Applied and Environmental Microbiology

    Article Title: SMU_1361c regulates the oxidative stress response of Streptococcus mutans

    doi: 10.1128/aem.01871-23

    Figure Lengend Snippet: Effect of smu_1361c on the growth, biofilm formation, and oxidative tolerance of S. mutans. (A) Growth characteristics of UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c. Bacteria were grown aerobically at 37°C, and OD600nm was monitored at 30-min intervals for 12 h. (B) The biofilm biomass was determined using crystal violet staining assay when bacteria were cultured in BHIS under aerobic conditions for 6, 12, and 24 h, respectively. The exponential cultures of UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c were exposed to oxidative stress with 0.2% (66.05 mM) hydrogen peroxide for 0, 20, 40, and 60 min, respectively, which were serially diluted and cultured on the BHI agar plates. The representative pictures of the hydrogen peroxide challenge are shown (C), colony-forming units were counted, and percent survivals of different strains were calculated relative to the control sample UA159 (D). The plates were overlaid with soft agar containing UA159, UA159/pDL278, UA159/pDL278-1361c, and UA159 Δ1361c and challenged with filter discs soaked with 0, 20, 40, and 60 mM hydrogen peroxide. The representative plates are shown to demonstrate the differences in inhibition zones (E), which are measured at three different positions and averaged to serve as a single data point, and the ratio of inhibition zone to disc diameter was calculated (F). Each experiment was repeated at least thrice. Results are presented as mean ± SD (*P < 0.05 or ***P < 0.001).

    Article Snippet: TABLE 1 Strains or plasmids Description Source S. mutans UA159 Wild-type strain ATCC 700610 UA159/pDL278 UA159 pDL278; Spe r This study UA159/pDL278 -1361c UA159/pDL278 -1361c; Spe r This study UA159 Δ 1361c UA159 Δ 1361c ; Em s ; p -Cl-Phe r This study S. gordonii S. gordonii Wild-type strain DL1 S. sanguinis S. sanguinis Wild-type strain SK36 E. coli DH5α F- φ80dlacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17 Laboratory stock (rk−, mk+) phoA supE44 λ- thi-1 gyrA96 relA1 BL21(DE3) F-ompT hsdS B(rB-mB-)dcm gal (DE3) Novagen Plasmids pET28a Kan r expression vector with the 6His-tag coding sequence Novagen pET 1361c pET derivative for expression 6His-1361c This study pDL278 E. coli-Streptococcus shuttle vector (Spe r ) ( 52 ) pDL278 -1361c pDL278 derivative for overexpression of smu_1361c in S. mutans This study Open in a separate window Bacterial strains and plasmids used in this study.

    Techniques: Bacteria, Staining, Cell Culture, Control, Inhibition

    Effect of smu_1361c on interspecies competition within the three-species biofilms. S. mutans and its derivatives, S. gordonii, and S. sanguinis were simultaneously cultured in fresh BHIS (A and B) or supplemented with 3 mg/mL catalase (C and D) under aerobic conditions for 24 h and labeled by species-specific FISH probes. The three-dimensional visualization of three-species biofilms with S. mutans (green), S. gordonii (blue), and S. sanguinis (red) was captured using the confocal laser scanning microscopy at 60× magnification and reconstructed using the IMARIS 7.0.0 (A and C). The ratio of S. mutans/S. gordonii/S. sanguinis was quantified by the coverage area of each species with Image Pro Plus 6.0 (B and D). The representative images are shown from at least five randomly selected positions of each sample. Results are presented as mean ± SD (*P < 0.05 or ****P < 0.0001).

    Journal: Applied and Environmental Microbiology

    Article Title: SMU_1361c regulates the oxidative stress response of Streptococcus mutans

    doi: 10.1128/aem.01871-23

    Figure Lengend Snippet: Effect of smu_1361c on interspecies competition within the three-species biofilms. S. mutans and its derivatives, S. gordonii, and S. sanguinis were simultaneously cultured in fresh BHIS (A and B) or supplemented with 3 mg/mL catalase (C and D) under aerobic conditions for 24 h and labeled by species-specific FISH probes. The three-dimensional visualization of three-species biofilms with S. mutans (green), S. gordonii (blue), and S. sanguinis (red) was captured using the confocal laser scanning microscopy at 60× magnification and reconstructed using the IMARIS 7.0.0 (A and C). The ratio of S. mutans/S. gordonii/S. sanguinis was quantified by the coverage area of each species with Image Pro Plus 6.0 (B and D). The representative images are shown from at least five randomly selected positions of each sample. Results are presented as mean ± SD (*P < 0.05 or ****P < 0.0001).

    Article Snippet: TABLE 1 Strains or plasmids Description Source S. mutans UA159 Wild-type strain ATCC 700610 UA159/pDL278 UA159 pDL278; Spe r This study UA159/pDL278 -1361c UA159/pDL278 -1361c; Spe r This study UA159 Δ 1361c UA159 Δ 1361c ; Em s ; p -Cl-Phe r This study S. gordonii S. gordonii Wild-type strain DL1 S. sanguinis S. sanguinis Wild-type strain SK36 E. coli DH5α F- φ80dlacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17 Laboratory stock (rk−, mk+) phoA supE44 λ- thi-1 gyrA96 relA1 BL21(DE3) F-ompT hsdS B(rB-mB-)dcm gal (DE3) Novagen Plasmids pET28a Kan r expression vector with the 6His-tag coding sequence Novagen pET 1361c pET derivative for expression 6His-1361c This study pDL278 E. coli-Streptococcus shuttle vector (Spe r ) ( 52 ) pDL278 -1361c pDL278 derivative for overexpression of smu_1361c in S. mutans This study Open in a separate window Bacterial strains and plasmids used in this study.

    Techniques: Cell Culture, Labeling, Confocal Laser Scanning Microscopy

    Transcriptomics analysis of UA159/pDL278 and UA159/pDL278-1361c strains. (A) Functional classification of differentially expressed genes (DEGs) was performed based on the clusters of orthologous groups type. (B) The volcano plot illustrates DEGs between UA159/pDL278 and UA159/pDL278-1361c. Functional annotation and enrichment analysis of DEGs were performed in the Kyoto Encyclopedia of Genes and Genomes (KEGG, C) and Gene Ontology (GO, D) databases. Downregulated genes are shown in green. (E) Genetic organization of gene clusters that were significantly downregulated in UA159/pDL278-1361c.

    Journal: Applied and Environmental Microbiology

    Article Title: SMU_1361c regulates the oxidative stress response of Streptococcus mutans

    doi: 10.1128/aem.01871-23

    Figure Lengend Snippet: Transcriptomics analysis of UA159/pDL278 and UA159/pDL278-1361c strains. (A) Functional classification of differentially expressed genes (DEGs) was performed based on the clusters of orthologous groups type. (B) The volcano plot illustrates DEGs between UA159/pDL278 and UA159/pDL278-1361c. Functional annotation and enrichment analysis of DEGs were performed in the Kyoto Encyclopedia of Genes and Genomes (KEGG, C) and Gene Ontology (GO, D) databases. Downregulated genes are shown in green. (E) Genetic organization of gene clusters that were significantly downregulated in UA159/pDL278-1361c.

    Article Snippet: TABLE 1 Strains or plasmids Description Source S. mutans UA159 Wild-type strain ATCC 700610 UA159/pDL278 UA159 pDL278; Spe r This study UA159/pDL278 -1361c UA159/pDL278 -1361c; Spe r This study UA159 Δ 1361c UA159 Δ 1361c ; Em s ; p -Cl-Phe r This study S. gordonii S. gordonii Wild-type strain DL1 S. sanguinis S. sanguinis Wild-type strain SK36 E. coli DH5α F- φ80dlacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17 Laboratory stock (rk−, mk+) phoA supE44 λ- thi-1 gyrA96 relA1 BL21(DE3) F-ompT hsdS B(rB-mB-)dcm gal (DE3) Novagen Plasmids pET28a Kan r expression vector with the 6His-tag coding sequence Novagen pET 1361c pET derivative for expression 6His-1361c This study pDL278 E. coli-Streptococcus shuttle vector (Spe r ) ( 52 ) pDL278 -1361c pDL278 derivative for overexpression of smu_1361c in S. mutans This study Open in a separate window Bacterial strains and plasmids used in this study.

    Techniques: Functional Assay

    Bacterial strains and plasmids used in this study

    Journal: Applied and Environmental Microbiology

    Article Title: SMU_1361c regulates the oxidative stress response of Streptococcus mutans

    doi: 10.1128/aem.01871-23

    Figure Lengend Snippet: Bacterial strains and plasmids used in this study

    Article Snippet: TABLE 1 Strains or plasmids Description Source S. mutans UA159 Wild-type strain ATCC 700610 UA159/pDL278 UA159 pDL278; Spe r This study UA159/pDL278 -1361c UA159/pDL278 -1361c; Spe r This study UA159 Δ 1361c UA159 Δ 1361c ; Em s ; p -Cl-Phe r This study S. gordonii S. gordonii Wild-type strain DL1 S. sanguinis S. sanguinis Wild-type strain SK36 E. coli DH5α F- φ80dlacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17 Laboratory stock (rk−, mk+) phoA supE44 λ- thi-1 gyrA96 relA1 BL21(DE3) F-ompT hsdS B(rB-mB-)dcm gal (DE3) Novagen Plasmids pET28a Kan r expression vector with the 6His-tag coding sequence Novagen pET 1361c pET derivative for expression 6His-1361c This study pDL278 E. coli-Streptococcus shuttle vector (Spe r ) ( 52 ) pDL278 -1361c pDL278 derivative for overexpression of smu_1361c in S. mutans This study Open in a separate window Bacterial strains and plasmids used in this study.

    Techniques: Expressing, Plasmid Preparation, Sequencing, Over Expression

    Alignment of AdcA of S. mutans with AdcA and AdcAII proteins of S. agalactiae. Dark and light grey shades represent identical and similar residues, respectively. Orange shaded residues are the N-terminal histidine rich metal-binding motif, yellow boxed residues depict the C-terminal ZinT domain while the glutamic acid and additional histidine residues that aid in metal recruitment are indicated in blue shades.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Alignment of AdcA of S. mutans with AdcA and AdcAII proteins of S. agalactiae. Dark and light grey shades represent identical and similar residues, respectively. Orange shaded residues are the N-terminal histidine rich metal-binding motif, yellow boxed residues depict the C-terminal ZinT domain while the glutamic acid and additional histidine residues that aid in metal recruitment are indicated in blue shades.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Binding Assay

    AdcABC mediates the growth of S. mutans under zinc-depleted conditions. Growth curves of UA159, ΔadcA, ΔadcCB or ΔadcCBcomp in (A) FMC, (B) FMC supplemented with 5 μM ZnSO4, (C) BHI, (D) CP/BHI medium containing 200 μg ml−1 of human calprotectin, and (E) BHI containing 10 μM TPEN. Curves shown represent average and standard deviation of at least five independent biological replicates.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: AdcABC mediates the growth of S. mutans under zinc-depleted conditions. Growth curves of UA159, ΔadcA, ΔadcCB or ΔadcCBcomp in (A) FMC, (B) FMC supplemented with 5 μM ZnSO4, (C) BHI, (D) CP/BHI medium containing 200 μg ml−1 of human calprotectin, and (E) BHI containing 10 μM TPEN. Curves shown represent average and standard deviation of at least five independent biological replicates.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Standard Deviation

    ICP-MS quantifications of intracellular zinc and manganese in the UA159, ΔadcA, ΔadcCB or ΔadcCBcomp strains. The bar graphs indicate zinc or manganese levels in cells grown in BHI (A and C) or BHI containing 6 μM TPEN (B and D). Data represent averages and standard deviations of three independent biological replicates. One-way ANOVA was used to compare the metal content of mutants and UA159 (*) and between ΔadcCB and ΔadcCBcomp (#). A p value <0.05 was considered significant.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: ICP-MS quantifications of intracellular zinc and manganese in the UA159, ΔadcA, ΔadcCB or ΔadcCBcomp strains. The bar graphs indicate zinc or manganese levels in cells grown in BHI (A and C) or BHI containing 6 μM TPEN (B and D). Data represent averages and standard deviations of three independent biological replicates. One-way ANOVA was used to compare the metal content of mutants and UA159 (*) and between ΔadcCB and ΔadcCBcomp (#). A p value <0.05 was considered significant.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques:

    The ΔadcCB mutant strain is hypersensitive to manganese. Mid-log grown cultures of UA159, ΔadcCB or ΔadcCBcomp were serially diluted and spotted on BHI agar containing different concentrations of manganese or zinc as indicated in the figure labels.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: The ΔadcCB mutant strain is hypersensitive to manganese. Mid-log grown cultures of UA159, ΔadcCB or ΔadcCBcomp were serially diluted and spotted on BHI agar containing different concentrations of manganese or zinc as indicated in the figure labels.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Mutagenesis

    Colonization of S. mutans UA159 or ΔadcCB on the teeth of rats. (A) Total S. mutans colonies recovered from rat jaws by plating on MS agar, and (B) percentage of S. mutans colonies among total recovered flora plated on blood agar plates. The limit of detection for CFU is 102. (*) Indicates statistical significance (p = 0.0003 (A) and 0.0002 (B) by Mann-Whitney test).

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Colonization of S. mutans UA159 or ΔadcCB on the teeth of rats. (A) Total S. mutans colonies recovered from rat jaws by plating on MS agar, and (B) percentage of S. mutans colonies among total recovered flora plated on blood agar plates. The limit of detection for CFU is 102. (*) Indicates statistical significance (p = 0.0003 (A) and 0.0002 (B) by Mann-Whitney test).

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: MANN-WHITNEY

    Expression of virulence-related attributes in the UA159, ΔadcA and ΔadcCB strains. (A) Growth in in the presence of a sub-inhibitory concentration of H2O2 (0.75 mM) in FMC supplemented with 5 μM (A) or 20 μM ZnSO4 (B). Curves shown represent average and standard deviation of at least five independent biological replicates. (C) 24-h biofilms formed on the surface of saliva-coated microtiter plate wells from cells grown in FMC supplemented with 1% sucrose in presence of varying amount of Zn. (*) Indicates statistical significance when compared to UA159 strain (p < 0.05, one-way ANOVA).

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Expression of virulence-related attributes in the UA159, ΔadcA and ΔadcCB strains. (A) Growth in in the presence of a sub-inhibitory concentration of H2O2 (0.75 mM) in FMC supplemented with 5 μM (A) or 20 μM ZnSO4 (B). Curves shown represent average and standard deviation of at least five independent biological replicates. (C) 24-h biofilms formed on the surface of saliva-coated microtiter plate wells from cells grown in FMC supplemented with 1% sucrose in presence of varying amount of Zn. (*) Indicates statistical significance when compared to UA159 strain (p < 0.05, one-way ANOVA).

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Expressing, Concentration Assay, Standard Deviation

    Bacterial strains and primers used in the study

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Bacterial strains and primers used in the study

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: